Skip to main content

Table 2 Primers for identification of bla KPC gene, bla OXA-48 gene and NDM-1 gene

From: Detection of carbapenemase-producing Enterobacteriaceae in rectal surveillance cultures in non-hospitalized patients

  Forward Reverse
BlaKPCgene (ATGTCACTGTATCGCCGTCT) (TTTTCAGAGCCTTACTGCCC)
blaOXA-48 gene (TTGGTGGCATCGATTATCGG) (GAGCACTTCTTTTGTGATGGC)
NDM-1 gene (GGTTTGGCGATCTGGTTTTC) (CGGAATGGCTCATCACGATC)